I have very little coding skills, so I can't write a program for this. I have looked for software, but couldn't find any (for OS X).
Anyway, here's my problem. I have a bunch (~1000) of DNA sequences that look similar to this:
DNA Sequence said:
GTTAAAGACGTGATCAAGGGTCTGGCCTGCGCAGAGCCCGAACTCGTTGAGATTGATACCGACATTCTTATGGTCGGTGGTGGTATGGGTAACTGCGGTACTGCTTTTGAAGCAGTGCGCTGGGCCGACAAAGTTGGCGGCGACATCAAGATCCTCTTGGTTGACAAGGCTGCTGTCGATCGCGGCGGCGCGGTTGCTCAGGGTCTTTCCGCCATCAACACCTATATCGGCGAGAACGATGTTGACGACTATGTCCGCATGGTCCGCACCGACCTCATGGGTATTGTTCGCGAAGACTTGATCTACGACCTTGGCCGCCACGTGGATGACTCCGTTCATCTGTTCGAAGAATGGGGCCTGCCTTGCTGGGTCAAGAAAGACGGCAAGAACCTGGACGGCGCTCA
And, I have a list of primers (which are short sequences of DNA used to bind to the above sequences) that I need to search the DNA sequences.
Right now, I am just using a text editor (TextWrangler) and I am using the search option to search with each primer one at a time. It's tedious to say the least.
I need to know what the percentage of matches for each primer against the DNA sequence file.
If anyone knows a way to batch search or if there is a program that can do this sort of thing, I would appreciate it!
Ex.
PrimerA
ACTGACTGACTGACTGAC - matched 343/1062 sequences
PrimerB
GTCAGTCAGTCAGTCAC - matched 10/1062 sequences